Title

Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osteocalcin gene

UMMS Affiliation

Department of Cell Biology

Date

3-1-1990

Document Type

Article

Subjects

Animals; Base Sequence; Calcitriol; Cell Line; DNA; DNA Probes; Deoxyribonuclease I; Gene Expression; Genes; Molecular Sequence Data; Nuclear Proteins; Nucleotide Mapping; Osteocalcin; Promoter Regions (Genetics); Protein Binding; Rats; Transcription Factors

Disciplines

Life Sciences | Medicine and Health Sciences

Abstract

By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, we have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACTGACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. We have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. Our results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3.

Rights and Permissions

Citation: Proc Natl Acad Sci U S A. 1990 Mar;87(5):1701-5.

Related Resources

Link to Article in PubMed

Journal Title

Proceedings of the National Academy of Sciences of the United States of America

PubMed ID

2308930